Anna Dumitriu received a Leverhulme Trust Artist in Residence Award in 2011 to work with the UK Clinical Research Consortium Project: Modernising Medical Microbiology led by The University of Oxford, Nuffield Centre for Clinical Medicine, which looks at the changing face of medical microbiology in light of the possibilities of (near) real-time whole genome mapping of bacteria and developments in bioinformatics. Work also takes place on the project in Brighton and Birmingham. Since 2012 she has been invited to continue in the artist in residence role and further develop her work.

As part of her residency she is shadowing researchers working with Tuberculosis, Staphylococcus aureus (and its drug resistant form MRSA), Norovirus and Clostridium dificile. The aim of the project is to communicate the impact of new technologies in microbiology and how they will improve understanding, diagnosis, treatment and control of infections. It is becoming possible to sequence whole bacterial genomes, make comparisons and even see whether bacteria carry genes for drug resistance. Bacteria are the most diverse and successful life-forms on Earth and with this technology we can know them a little better.

"The MRSA Quilt" tells the story of MRSA (Methicillin Resistant Staphylococcus aureus) research and diagnosis through a textile work stained with MRSA bacteria (grown on chromogenic agar) as it undergoes a number of commonly used tests. The final work has been autoclaved and made safe. Made in collaboration with Dr John Paul, Dr James Price and Rosie Sedgwick. There is huge gap between the public’s understanding of the issue of hospital acquired pathogens or ‘superbugs’ as the press describe them. MRSA is a mutated form of Staphylococcus aureus which is part of our normal bacterial flora and thought to be carried by around 25% of the population (this figure could potentially be much higher as it may simply be that our testing methods are flawed). MRSA has acquired genes which mean that it can withstand treatment with Methicillin based antibiotics. However Vancomycin is usually still effective. MRSA is not only acquired from hospitals, there is also community acquired MRSA. In hospitals patients are more susceptible to infections if they are immune compromised or have operation woulds hence the risk of MRSA there. Patients are routinely tested. However transmission vectors (how the bug moves from person to person) are not properly understood and the Modernising Medical Microbiology Project is now using whole genome mapping of bacteria to try to understand far more about this important factor.

The spa gene (surface protein A gene) of the Staphylococcus aureus (non MRSA) found to be living in Dumitriu’s nose is:

GCACCAAAAGAGGAAGACAACAACAAGCCTGGTAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGCAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACAACAACAAAMCTGGTAAAGAAGACGGCAACAAGCCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACGGCAACGGAGTACATGTCGT

Looking at the spa gene is a typing method for Staphylococcus aureus, Dumitriu colonised with is spa type t015, which corresponds to sequence type ST45 (not the most common type seen in hospitals).

By making her colonisation with Staphylococcus aureus explicit, Dumitriu is demonstrating the gap between the media’s presentation of this bug and the scientific reality. The point being we are colonised by a huge number of bacteria, many of which are integral to our well-being. The science behind this work is revealing that there is a far greater story to be told than the “dirty hospitals” rhetoric of the press and Dumitriu’s work offers a way in to the story for many people who would otherwise have no access to it. Quilts are a traditional way of passing down stories. Dumitriu’s MRSA project continues and on 14th March 2012 Dumitriu ran a MRSA/MSSA quilt making workshop at the Biomedical Research Open Day as part of Oxford Science Festival.

Dumitriu has also now been trained to shadow work safely in a Category 3 Laboratory and will shortly be commencing the next stage of the residency which will involve research into Mycobacterium tuberculosis which causes TB. TB is the world’s largest infectious killer and is carried by around one third of the population of this planet.

The MRSA Quilt was exhibited at R-Space at The Linen Rooms in Lisburn, Northern Ireland until 17th September 2011. It then travelled to the V & A Museum in London where it was shown as part of the Digital Design Weekend for the London Design Festival on 24th and 25th September 2011.

"MRSA/MSSA Quilt making workshop" at the Oxford Biomedical Research Centre Open Day

As part of the Oxford Biomedical Research Centre Open Day, Anna Dumitriu led a 'drop in' MRSA/MSSA (Methicillin resistant and susceptible Staphylococcus aureus bacteria) quilt making session. Participants were able to create quilt squares using natural and clinical antibiotics on Chromogenic agar and then the squares were (remotely) inoculated with bacteria and the results can be seen below. They will also used to create a new artwork which will be exhibited at Anna Dumitriu's forthcoming show at St John's College Barn Gallery in Oxford in May 2012. Participants were able to learn about new developments and technologies in microbiology and have the opportunity to ask her and her colleague biomedical scientist Kevin Cole, all the questions they have always wondered about bacteria in a relaxed and creative atmosphere. The event took place at the Biomedical Research Centre, Churchill Hospital. Oxford, UK on Wednesday 14th March 2012.

The work will be shown at The Barn Gallery, St Johns College, University of Oxford 23rd - 27th May 2012 as part of Anna Dumitriu’s new exhibition “Normal Flora: Bioart Responses To Modernising Medical Microbiology”.